View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0553_low_12 (Length: 379)

Name: NF0553_low_12
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0553_low_12
NF0553_low_12
[»] chr6 (3 HSPs)
chr6 (296-374)||(31935817-31935897)
chr6 (88-153)||(31936033-31936106)
chr6 (238-275)||(31935914-31935951)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 296 - 374
Target Start/End: Complemental strand, 31935897 - 31935817
Alignment:
296 atacacatattggtgtgtgt--aataaaaactgatgtaaatcaagctgagaagttggtatagacagtatacctttgctact 374  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||    
31935897 atacacatattggtgtgtgtgtaataaaaactgatgtaaatcaagctgagaagttggtatagacggtatacctttggtact 31935817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 88 - 153
Target Start/End: Complemental strand, 31936106 - 31936033
Alignment:
88 ataaatccattttgttatgacatggtcaaaactatgtc--------agagttgttgactatgttaagaacggtt 153  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||    
31936106 ataaatccattttgttatgacatggtcaaaactatgtcagagactcagagttgttgactatgttaagaacggtt 31936033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 275
Target Start/End: Complemental strand, 31935951 - 31935914
Alignment:
238 tgttctaacataaatgattcatattaaagatgaatacc 275  Q
    ||||||||||||||||||||||||||||||||||||||    
31935951 tgttctaacataaatgattcatattaaagatgaatacc 31935914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University