View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_12 (Length: 379)
Name: NF0553_low_12
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 296 - 374
Target Start/End: Complemental strand, 31935897 - 31935817
Alignment:
| Q |
296 |
atacacatattggtgtgtgt--aataaaaactgatgtaaatcaagctgagaagttggtatagacagtatacctttgctact |
374 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
31935897 |
atacacatattggtgtgtgtgtaataaaaactgatgtaaatcaagctgagaagttggtatagacggtatacctttggtact |
31935817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 88 - 153
Target Start/End: Complemental strand, 31936106 - 31936033
Alignment:
| Q |
88 |
ataaatccattttgttatgacatggtcaaaactatgtc--------agagttgttgactatgttaagaacggtt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31936106 |
ataaatccattttgttatgacatggtcaaaactatgtcagagactcagagttgttgactatgttaagaacggtt |
31936033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 238 - 275
Target Start/End: Complemental strand, 31935951 - 31935914
Alignment:
| Q |
238 |
tgttctaacataaatgattcatattaaagatgaatacc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935951 |
tgttctaacataaatgattcatattaaagatgaatacc |
31935914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University