View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_15 (Length: 353)
Name: NF0553_low_15
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 320
Target Start/End: Original strand, 35426243 - 35426534
Alignment:
| Q |
18 |
atcaaaagaattcaagtctttgtataacttgcgtcgatcgatgaacacaaccttacttgaacataatctgttttttaggatcataaaagtgtgtctttga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
35426243 |
atcaaaagaattcaagtctttgtataacttgcgtcgatcgatgaacacaaccttacttgaacataatctgttttttaggatcatacaagtgtatctttga |
35426342 |
T |
 |
| Q |
118 |
tttccgtgtgatcagagtgtgattaacgctgagagcatctgtttgagacatcatctgtgctgtagaggatcgatctcagcctcggccagggatgtctgac |
217 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35426343 |
tttccgtgt-----------gattaacgcggagagcatctgtttgagacatcatctgtgctgtagaggatcgatctcagcctcggccagggatgtctgac |
35426431 |
T |
 |
| Q |
218 |
agagtcaactataatagacaccaaatttttacagaaaggaatggcattgattaacttgaatttccccttcttgttgattgtgatgtgtggtggtgaccat |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35426432 |
agagtcaactataatagacaccaaatttttacagaaaggaatggcattgattaacttgaatttccccttcttgttgattgtgatgtgtggtcgtgaccat |
35426531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University