View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_18 (Length: 339)
Name: NF0553_low_18
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_18 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 120 - 339
Target Start/End: Original strand, 10101860 - 10102079
Alignment:
Q |
120 |
agcatctaaccacgacacgattttgacagaaacacaaacatcaaactttgagtcaaatttcaacaaaatatttatatattatgatatgcagatatagcct |
219 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10101860 |
agcatctaaccgcgatacgattttgacagaaacacaaacatcaaactttgagtcaaatttcaacaaaatatttatatattatgatatgcagatatagcct |
10101959 |
T |
 |
Q |
220 |
gcataaaagatgtgcaaaaagctatccattctatgttttaatacaacctggagtgaaagtttaacaatattagtataaaaatatgaattacacacaagct |
319 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
10101960 |
acataaaagatgtgcaaaaagctatccattctatgttttaatacaacctggagtgaaagtttaacaatattagtataaaaatatgaattacacaaaagct |
10102059 |
T |
 |
Q |
320 |
tgtgaaatgcttttatcctt |
339 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
10102060 |
tgtgaaatgcttttatcctt |
10102079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University