View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_19 (Length: 338)
Name: NF0553_low_19
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 26315792 - 26315980
Alignment:
| Q |
1 |
acaacccagttatcgctgtcacattcgataatggttttgtcaaagtcgaaaaccactacaataatagccata--atggtgacagagaaatattttgtttg |
98 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
26315792 |
acaacccagttatcgctgtcacattcaataatggttttgtcaaagtcgaaaaccactacaatactagccataatatggtgacaaagaaatattttgtttg |
26315891 |
T |
|
| Q |
99 |
tttttgagaaaaccaagaatttattatactacaatacgtagcacaagacatgc-nnnnnnngcacgtaaagaaaggatacaattcaaaa |
186 |
Q |
| |
|
||||| | |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26315892 |
tttttaaaaaaaccaagaatttattatactgcaatacgtagcacaagacatgcaaatataagcacgtaaagaaaggatacaattcaaaa |
26315980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 43110900 - 43110973
Alignment:
| Q |
1 |
acaacccagttatcgctgtcacattcgataatggttttgtcaaagtcgaaaaccactacaataatagccataat |
74 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||||| |||||||| |||||| |||||||||| |
|
|
| T |
43110900 |
acaacccagttatcactgtcacattcaactatggttttgtcaaagtcaaaaaccacaacaatattagccataat |
43110973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 282 times since January 2019
Visitors: 3649