View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_23 (Length: 329)
Name: NF0553_low_23
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 85 - 235
Target Start/End: Complemental strand, 33624028 - 33623878
Alignment:
| Q |
85 |
agaaagagattctagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctattcggattgttacgaactgc |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33624028 |
agaaagagatactagaaacagttgttatgaatcttccaccggaaaagaatctgaattcgtcaacagcaacaaggtttctatttggattgttacgaactgc |
33623929 |
T |
 |
| Q |
185 |
gaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33623928 |
gaatatactaaacgcttcagaatcatgtagaaacgctttggagaagaaaat |
33623878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University