View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_25 (Length: 326)
Name: NF0553_low_25
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 41 - 292
Target Start/End: Original strand, 28155786 - 28156053
Alignment:
Q |
41 |
aaccaaaccactttaaccacagtaagtgtttccattttcatggactcattgcctcacaca----------------atgttctgctcaatgaatcaaaat |
124 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
T |
28155786 |
aaccaaaccactttaaccacagtaagtgtctccattttcatggactcattgcctcacatacacttccatgccaataatgttctgctcaatgaatcaaaat |
28155885 |
T |
 |
Q |
125 |
gtgaagaagcaactaccaattgtagatctcaagagttaagtaggtgaatcaaatcaacccctacccaaccacatgcattaaacaatttcgatatcttcca |
224 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28155886 |
gtgaagaagcaactaccaattgtagatctcaagagttaagtaggtgaatcaaatcaacccctacccaaccacatgcattaaacaatttcgatatcttcca |
28155985 |
T |
 |
Q |
225 |
cacaaattaacaatagcttattgttaacaaaaaccaaattagctacaacatacacctaattactagct |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
28155986 |
cacaaattaacaatagcttattgttaacaaaaaccaaattagcttaaacatacacctaattactagct |
28156053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University