View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_29 (Length: 300)
Name: NF0553_low_29
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 79 - 236
Target Start/End: Complemental strand, 26232294 - 26232137
Alignment:
Q |
79 |
atcatgagtatcatgtatgatttaacttctttaaaaaatgagtatctttataaaataattgatttccttgccttagacaacgatctacctctccaaaatt |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26232294 |
atcatgagtatcatgtatgatttaacttctttaaaaaatgagtatctttataaaataattgatttccttgccttagacaacgatctacctctccaaaatt |
26232195 |
T |
 |
Q |
179 |
gattttgtttcaaaccccataatgccttagacaactatctacctccccatgaattgat |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26232194 |
gattttgtttcaaaccccataatgccttagacaactatctacctccccatgaattgat |
26232137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University