View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_30 (Length: 299)
Name: NF0553_low_30
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 45659188 - 45659011
Alignment:
| Q |
1 |
acaagaacatattttgcatcaaa-ttcaaatcagcaaaaaacagaaccaacaaagagtttttgtttatacttcagcttaccaaaaataaacatagaagcc |
99 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659188 |
acaagaacatagtttgcatcaaaattcaaatcagcaaaaaacagaaccaacaaagagtttttgtttatacttcagcttaccaaaaataaacatagaagcc |
45659089 |
T |
|
| Q |
100 |
ctgaatccacctttctttctcttccattcagtgagaagcttgagttcttcagtttcctcttgatctgcctgtattaca |
177 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659088 |
ctaaatccacctttctttctcttccattcagtgagaagcttgagttcttcagtttcctcttgatctgcctgtattaca |
45659011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1099 times since January 2019
Visitors: 3663