View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_4 (Length: 535)
Name: NF0553_low_4
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_4 |
 | |
|
| [»] scaffold0464 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 83 - 382
Target Start/End: Original strand, 19638027 - 19638324
Alignment:
| Q |
83 |
cagagatgatggttttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcatcagggag |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19638027 |
cagagatgatggttttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcgtcagggag |
19638126 |
T |
|
| Q |
183 |
gaacacgcgcgaaattctagttccattgaaggtacgccgcaacttaggttgatgatgagcactcatgagatgagagcttcgctttttggaatttttctca |
282 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19638127 |
gaacacgcgcgaaattctagttccactgaaggtacgccgcaacttaggttgatgatgagcactcatgagatgagagcttcgctttttggattttttctca |
19638226 |
T |
|
| Q |
283 |
caaagaggattcatgaggaaggaagaaagggattcggagcttggtgagaaggaagggtatgcctttgggagttgaagatttctaaaccctagtaagtaat |
382 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
19638227 |
c--agaggattcatgaggaaggaagaaagggattcggagcttggtgagaaggaagggtatgcctttgggagtagaagatttctaaaccctaataagtaat |
19638324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 84 - 194
Target Start/End: Original strand, 19598581 - 19598691
Alignment:
| Q |
84 |
agagatgatggttttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcatcagggagg |
183 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||| ||| ||| | || || | |||||||||||||| ||| | ||| ||||||||||||||| |
|
|
| T |
19598581 |
agagattagggttttccatgacttgcagacgcatttgaattgcacaagagaatttacaggaaggaatgataggatttcaacgataagttcatcagggagg |
19598680 |
T |
|
| Q |
184 |
aacacgcgcga |
194 |
Q |
| |
|
|| ||| |||| |
|
|
| T |
19598681 |
aatacgagcga |
19598691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 93 - 184
Target Start/End: Original strand, 15572759 - 15572850
Alignment:
| Q |
93 |
ggttttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcatcagggagga |
184 |
Q |
| |
|
||||||||| ||| ||||||| || || | ||||||||||||||||| |||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
15572759 |
ggttttccaggacctgcagacgcacttcatccgcatcagatatttcacttcaaggaacgataggacttccacaataagttcatcagggagga |
15572850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 96 - 182
Target Start/End: Original strand, 19610222 - 19610308
Alignment:
| Q |
96 |
tttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcatcagggag |
182 |
Q |
| |
|
|||||||||||||||||| || || || ||||||||| ||||||||| || ||||| |||||||| |||||| |||| |||||| |
|
|
| T |
19610222 |
tttccatgacttgcagacgcacttaaatcgcatcagagatttcaccgggagaaatgacaggacttcggtgattaactcattagggag |
19610308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 93 - 190
Target Start/End: Original strand, 29598353 - 29598450
Alignment:
| Q |
93 |
ggttttccatgacttgcagacacatttgaaacgcatcagatatttcaccgaaaggaatgataggacttccatgattagttcatcagggaggaacacgc |
190 |
Q |
| |
|
|||||||||||||||||| ||||| | | ||||||||| ||| ||| | ||||||||| |||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
29598353 |
ggttttccatgacttgcacacacaccttagtcgcatcagagattgcacaggaaggaatgaaaggacttctgcgatgagttcatcagggaggaatacgc |
29598450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0464 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0464
Description:
Target: scaffold0464; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 84 - 132
Target Start/End: Complemental strand, 7261 - 7213
Alignment:
| Q |
84 |
agagatgatggttttccatgacttgcagacacatttgaaacgcatcaga |
132 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
7261 |
agagattagggttttccatgatttgcagacacatttgaattgcatcaga |
7213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1302 times since January 2019
Visitors: 3643