View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_40 (Length: 269)
Name: NF0553_low_40
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_40 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 29 - 269
Target Start/End: Original strand, 12473495 - 12473735
Alignment:
Q |
29 |
aattagttgtttaattgttcttggatggtttgattacaattattaaagcaataaaccatttagttgaaataatttgtgcatatcttttcaaacttttggg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12473495 |
aattagttgtttaattgttcttggatggtttgattacaattattaaagcaataaaccatttagttgaaataatttgtgcatatcttttcaaacttttggg |
12473594 |
T |
 |
Q |
129 |
ttattaatatttgctcctataatgttagctttatgaacgaacttttttgagatggttttgcaggaaaatatctacgacttctctgtctctctcataannn |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
T |
12473595 |
ttattaatatttgctcctataatgttagctttatgaacgaacttttttgagatggttttgcaggaaaatatctacgacttctctttctctctcttaattt |
12473694 |
T |
 |
Q |
229 |
nnnnnnccttttcttatatctcctatttcaaccttggctca |
269 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
12473695 |
ttctttccttttcttatatctcctatttcaaccttggctca |
12473735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 49 - 142
Target Start/End: Original strand, 12457537 - 12457632
Alignment:
Q |
49 |
ttggatggtttgattacaattattaaagcaataaaccatttagttgaaataatttgtgcata-tcttttcaaa-cttttgggttattaatatttgc |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||| | |||||||| ||||||||||||| ||||||| |
|
|
T |
12457537 |
ttggatggtttgattacaattattaaagcaataaactatttagttgaaataatttgcgtatatttttttcaaattttttgggttattattatttgc |
12457632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University