View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_41 (Length: 268)
Name: NF0553_low_41
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 72 - 248
Target Start/End: Complemental strand, 17872637 - 17872460
Alignment:
| Q |
72 |
tgagaaaataaatattaaatagataatttaattgatatgtacatataacgtaaatatattttaatcatgcattatttgccttcacattatttaatctaga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17872637 |
tgagaaaataaatattaaatagataatttatttgatatgtacatataacgtaaatatattttaatcatgcattatttgccttcacattatttaatctaga |
17872538 |
T |
|
| Q |
172 |
gggaaaaatatgtg-ttttccctttttaacctcataatttgaacatcatgtagcatcactttaattaataacaattct |
248 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17872537 |
gggaaaaatttgtgtttttccctttttaacctcataatttgaacatcatgtagcatcactttaattaataataattct |
17872460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 72 - 178
Target Start/End: Complemental strand, 17862062 - 17861956
Alignment:
| Q |
72 |
tgagaaaataaatattaaatagataatttaattgatatgtacatataacgtaaatatattttaatcatgcattatttgccttcacattatttaatctaga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17862062 |
tgagaaaataaatattaaatagataatttatttgatatgtacatataacgtaaatatattttactcatgcattatttgccttcactttatttaatctaga |
17861963 |
T |
|
| Q |
172 |
gggaaaa |
178 |
Q |
| |
|
||||||| |
|
|
| T |
17861962 |
gggaaaa |
17861956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 36141421 - 36141458
Alignment:
| Q |
30 |
aatatgtttgaattggctgatcgacttgttggtattta |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36141421 |
aatatgtttgaattggctgatcgacttgttggtattta |
36141458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 30822029 - 30822066
Alignment:
| Q |
30 |
aatatgtttgaattggctgatcgacttgttggtattta |
67 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30822029 |
aatatgtttgaattggctgaccgacttgttggtattta |
30822066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 111 times since January 2019
Visitors: 3647