View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_46 (Length: 252)
Name: NF0553_low_46
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 12473720 - 12473965
Alignment:
Q |
1 |
tttcaaccttggctcaagttcaatccacttatggacttgctcactagggagtatgctatgagattccccaggggagcacccaagagaatccggtaatggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12473720 |
tttcaaccttggctcaagttcaatccacttatggacttgctcactagggagtatgctatgagattccccaggggagcacccaagagaatccggtaatggt |
12473819 |
T |
 |
Q |
101 |
gatcaaatgttgatct-------acgtcgaggacagtctaacaaaatcaattattctgacaggaaaattctacagtcttccttataattaaggacatttg |
193 |
Q |
|
|
|||||||||||||| | |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
12473820 |
gatcaaatgttgatatgcaaataacgtcgaggacagtctaacaaaatcaatgattccgacaggaaaattctacagtcttccttataattaaggacagatg |
12473919 |
T |
 |
Q |
194 |
atcgttaaagggacacattctctaaaccctaaaaacttcaccccct |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12473920 |
atcgttaaagggacacattctctaaaccctaaaaacttcaccccct |
12473965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1161 times since January 2019
Visitors: 3663