View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0553_low_46 (Length: 252)

Name: NF0553_low_46
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0553_low_46
NF0553_low_46
[»] chr1 (1 HSPs)
chr1 (1-239)||(12473720-12473965)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 12473720 - 12473965
Alignment:
1 tttcaaccttggctcaagttcaatccacttatggacttgctcactagggagtatgctatgagattccccaggggagcacccaagagaatccggtaatggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12473720 tttcaaccttggctcaagttcaatccacttatggacttgctcactagggagtatgctatgagattccccaggggagcacccaagagaatccggtaatggt 12473819  T
101 gatcaaatgttgatct-------acgtcgaggacagtctaacaaaatcaattattctgacaggaaaattctacagtcttccttataattaaggacatttg 193  Q
    |||||||||||||| |       |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||  ||    
12473820 gatcaaatgttgatatgcaaataacgtcgaggacagtctaacaaaatcaatgattccgacaggaaaattctacagtcttccttataattaaggacagatg 12473919  T
194 atcgttaaagggacacattctctaaaccctaaaaacttcaccccct 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
12473920 atcgttaaagggacacattctctaaaccctaaaaacttcaccccct 12473965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1161 times since January 2019
Visitors: 3663