View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_49 (Length: 248)
Name: NF0553_low_49
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 236
Target Start/End: Complemental strand, 30414551 - 30414318
Alignment:
Q |
3 |
ccttgtaacacatggcgccaaatcgcaagaggaataataacaatcaccaaggattttcacatcaaatactcgtgaccttggttaaattatatttggtcta |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30414551 |
ccttgtaacacatggcgccaaatcgcaagaggaataataacaatcaccaaggattttcacatcaaatactcgtgaccttggttaaattatatttggtcta |
30414452 |
T |
 |
Q |
103 |
gtagctttgtactaaagcaaggtgtacatcgcacgacattgatagttggttcattgtgcattggtccttggaaatgtttaaaacttcatggacaacaaat |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
30414451 |
gtagctttgtactaaagcaaggtgtacatcgcacgacattgatagttggttcattgtgcattggtccttggaaatgtttaaaacttcatcgacaacaaat |
30414352 |
T |
 |
Q |
203 |
cannnnnnnnngggaagtagaaactcacaaccct |
236 |
Q |
|
|
|| |||||||||||||||||||||| |
|
|
T |
30414351 |
cattttttttttggaagtagaaactcacaaccct |
30414318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1242 times since January 2019
Visitors: 3665