View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0553_low_60 (Length: 208)

Name: NF0553_low_60
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0553_low_60
NF0553_low_60
[»] chr1 (1 HSPs)
chr1 (1-190)||(25167941-25168130)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 25167941 - 25168130
Alignment:
1 ttcttaaggcaagatacgggactttaaccccgtcccctcatcttggggaaaatccaggggtcttcggtaggtagactttacagtggaggcgattaggttt 100  Q
    |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||    
25167941 ttcttaagacaagatacgggactttaaccccgtctcctcatcttggggaaaatccagaggtctttggtaggtagactttacagtggaggcgattaggttt 25168040  T
101 atctcttttcttctgggaggtggaattggtatctgagcttctccggttactaccttaggtagggttctaggagagactggatgtttgatg 190  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||    
25168041 atctcttttcttctgggaggtggaattggtatctgagcttcttcggttactaccttaagtagggttctaggagagactagatgtttgatg 25168130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University