View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_60 (Length: 208)
Name: NF0553_low_60
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 25167941 - 25168130
Alignment:
Q |
1 |
ttcttaaggcaagatacgggactttaaccccgtcccctcatcttggggaaaatccaggggtcttcggtaggtagactttacagtggaggcgattaggttt |
100 |
Q |
|
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
25167941 |
ttcttaagacaagatacgggactttaaccccgtctcctcatcttggggaaaatccagaggtctttggtaggtagactttacagtggaggcgattaggttt |
25168040 |
T |
 |
Q |
101 |
atctcttttcttctgggaggtggaattggtatctgagcttctccggttactaccttaggtagggttctaggagagactggatgtttgatg |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
T |
25168041 |
atctcttttcttctgggaggtggaattggtatctgagcttcttcggttactaccttaagtagggttctaggagagactagatgtttgatg |
25168130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University