View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_63 (Length: 201)
Name: NF0553_low_63
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0553_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 55074063 - 55074134
Alignment:
Q |
1 |
ctcccctgttcaattgtaccatccaattgatac--tatggcaatgcatcgatactaagttatattcttcgac |
70 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| | |||||| |
|
|
T |
55074063 |
ctcccctgttcaattgtaccatccaattgatactatatgtcaatgcatcgatactaagttataattttcgac |
55074134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 375 times since January 2019
Visitors: 3650