View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0553_low_7 (Length: 415)
Name: NF0553_low_7
Description: NF0553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0553_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 21482958 - 21483267
Alignment:
| Q |
30 |
ctaacaataatatacagcttaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggt |
129 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482958 |
ctaacaataatataaagctgaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggt |
21483057 |
T |
|
| Q |
130 |
ccactggaggctgcgtcggctcagccggaacaacaggtgccaaggaagctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483058 |
ccactggaggctgcgtcggctcagccggaacaacaggtgccaaggaggctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgc |
21483157 |
T |
|
| Q |
230 |
atgagaaccaccagcagcaacattggtgcaattatcaccactacctaatctcgcaagtggatcagaaccttgaatattctgatgatggttattattatga |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21483158 |
atgagaaccaccagcagcaacattggtgcaactatcaccactacctaatctcgcaagtggatcagaaccttgaatattctgatgatggttaatattatga |
21483257 |
T |
|
| Q |
330 |
tgcctatgat |
339 |
Q |
| |
|
|||||||||| |
|
|
| T |
21483258 |
tgcctatgat |
21483267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 108 times since January 2019
Visitors: 3647