View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0554_low_15 (Length: 219)
Name: NF0554_low_15
Description: NF0554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0554_low_15 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 87 - 219
Target Start/End: Original strand, 49290605 - 49290737
Alignment:
Q |
87 |
catcatcaaagattcttatggtcaagtgttgtgttgattcgtcttcaataatgaattcaaagtgctcattccatattgggttcaactggttgttctgaga |
186 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49290605 |
catcatcaaagattcttatggtcaagtgttgtgttgattcgtcttcaataatgaattcaaagtgctcattccatattgggttcaactggttgttctgagc |
49290704 |
T |
 |
Q |
187 |
atgaccaataattatattatgatttgcaaccac |
219 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
49290705 |
atgaccaataattatattatgatttgcaaccac |
49290737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University