View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0554_low_8 (Length: 280)
Name: NF0554_low_8
Description: NF0554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0554_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 37931647 - 37931430
Alignment:
Q |
18 |
agatagtgtgcgaaaaatgggtcctcaatcaaccataaacattagaggaatttagtgtctatagtttgatgatcatgcacaccagaacaagtcaaataaa |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37931647 |
agatagtgtgcgaaaaatgggtcctcaatcaaccataaacattagaggaatttagtgtctatagtttgatgatcatgcacaccagaacaagtcaaataaa |
37931548 |
T |
 |
Q |
118 |
ttgggcaaaaaattaatattatttaactaagaaaatataatggaatttgttaaagcataaaattatatgcacaaagaaaagataaggttgaaaagtacat |
217 |
Q |
|
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37931547 |
ttgggcaaaaaattaatataattcaactaagaaaatataatggaatttgttaaagcataaaattatatgcacaaagaaaagataaggttgaaaagtacat |
37931448 |
T |
 |
Q |
218 |
ggcaattcatggaaattg |
235 |
Q |
|
|
|| ||||||||||||||| |
|
|
T |
37931447 |
ggtaattcatggaaattg |
37931430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University