View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0554_low_9 (Length: 272)

Name: NF0554_low_9
Description: NF0554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0554_low_9
NF0554_low_9
[»] chr3 (1 HSPs)
chr3 (93-233)||(49290992-49291123)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 49291123 - 49290992
Alignment:
93 caaattcatgttgatgaatcttcaattttctgagagagttgattgctatcttggttgttggcatgtattgatcgtattgcattttattttggaattataa 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49291123 caaattcatgttgatgaatcttcaattttctgagagagttgattgctatcttggttgttggcatgtattgatcgtattgcattttattttggaattataa 49291024  T
193 attaattatatcattgtcatttctacatgttttgaatatta 233  Q
             ||||||||||||||||||||||||||||||||    
49291023 ---------atcattgtcatttctacatgttttgaatatta 49290992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University