View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0554_low_9 (Length: 272)
Name: NF0554_low_9
Description: NF0554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0554_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 93 - 233
Target Start/End: Complemental strand, 49291123 - 49290992
Alignment:
| Q |
93 |
caaattcatgttgatgaatcttcaattttctgagagagttgattgctatcttggttgttggcatgtattgatcgtattgcattttattttggaattataa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49291123 |
caaattcatgttgatgaatcttcaattttctgagagagttgattgctatcttggttgttggcatgtattgatcgtattgcattttattttggaattataa |
49291024 |
T |
|
| Q |
193 |
attaattatatcattgtcatttctacatgttttgaatatta |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49291023 |
---------atcattgtcatttctacatgttttgaatatta |
49290992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 931 times since January 2019
Visitors: 3660