View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_high_10 (Length: 346)
Name: NF0555_high_10
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0555_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 30 - 336
Target Start/End: Complemental strand, 6562708 - 6562404
Alignment:
| Q |
30 |
aataatattgtcatatcagtttttcaatatacttatttagtgacatataaatctctataaatatttattgtcgtataatctctatatnnnnnnnnnnnnt |
129 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| || ||||| ||||||||||| ||||||||||||||| ||||||||| | |
|
|
| T |
6562708 |
aataatattgtcatatcagattt-caatatacttatttaatgtcatatcaatctctataattatttattgtcgtatgatctctata--aaaaaaaaaaat |
6562612 |
T |
|
| Q |
130 |
gactctgactattataacaatgactaacgaaacgtacaatcaaataccgattattgtgactgctagttgcctaaccaaaaataactatttacccgatgaa |
229 |
Q |
| |
|
||| | | |||||| || |||| |||||||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| || |
|
|
| T |
6562611 |
gacagtcaatattatgactatgattaacgaaatgtacaatcaaataccgattattgtgaccgtaagttgcctaaccaaaaataactatttacccgatcaa |
6562512 |
T |
|
| Q |
230 |
gagagggtaactaggtcccaaaagaaagg-taactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaact |
328 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6562511 |
gagagggtaactaggtccctaaaaaaagggtaactaggaactaacaacggtaacaaaaagaggttctagttgtactacaacgaatctcaatgttttaact |
6562412 |
T |
|
| Q |
329 |
gctctctg |
336 |
Q |
| |
|
|||||||| |
|
|
| T |
6562411 |
gctctctg |
6562404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 1901621 - 1901678
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatataaatctctataa |
89 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||| || ||||| ||||| ||||| |
|
|
| T |
1901621 |
taatattgtcatattaatttttcaatatatttatttattgtcatatcaatctttataa |
1901678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 39331142 - 39331092
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatataaatc |
82 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| || ||||| |||| |
|
|
| T |
39331142 |
taatattgttatatcagtctttcaatatacttatttattgtcatatcaatc |
39331092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 96
Target Start/End: Complemental strand, 2251441 - 2251387
Alignment:
| Q |
42 |
atatcagtttttcaatatacttatttagtgacatataaatctctataaatattta |
96 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||| || ||||||||||||||| |
|
|
| T |
2251441 |
atatcagtttctcaatatatttatttatcgacatatcaacctctataaatattta |
2251387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 36145026 - 36144981
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatat |
77 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| || ||||| |
|
|
| T |
36145026 |
taatattgtcatattagtttttcaatatacttagttattgtcatat |
36144981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 95
Target Start/End: Complemental strand, 29927697 - 29927636
Alignment:
| Q |
34 |
atattgtcatatcagtttttcaatatacttatttagtgacatataaatctctataaatattt |
95 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||| || ||||| ||| |||||| |||||| |
|
|
| T |
29927697 |
atattgtcatattagttcttcaataaacttatttattgtcatattaatttctatagatattt |
29927636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 20948291 - 20948336
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatat |
77 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
20948291 |
taatattatcatatcagttcttcaatatacttatttattgtcatat |
20948336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 30843669 - 30843714
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatat |
77 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| || ||||| |
|
|
| T |
30843669 |
taatattgtcatattagtctttcaatatacttatttattgtcatat |
30843714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 92
Target Start/End: Original strand, 24255332 - 24255392
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttatttagtgacatataaatctctataaata |
92 |
Q |
| |
|
||||||| |||||| |||| ||||||| |||||||| || ||||| |||||||||||||| |
|
|
| T |
24255332 |
taatattatcatattagttcatcaatatgcttatttattgtcatatcaatctctataaata |
24255392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 5198059 - 5198023
Alignment:
| Q |
32 |
taatattgtcatatcagtttttcaatatacttattta |
68 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5198059 |
taatattgtcatattagtctttcaatatacttattta |
5198023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 33 - 77
Target Start/End: Original strand, 29197030 - 29197074
Alignment:
| Q |
33 |
aatattgtcatatcagtttttcaatatacttatttagtgacatat |
77 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| || ||||| |
|
|
| T |
29197030 |
aatattgtcatatcagtctttcaatatacttacttattgtcatat |
29197074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1834 times since January 2019
Visitors: 3673