View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_12 (Length: 388)
Name: NF0555_low_12
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0555_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 27296006 - 27295697
Alignment:
| Q |
1 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27296006 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt |
27295907 |
T |
|
| Q |
101 |
caaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaagctctcattcaatccaaataccttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295906 |
caaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgattcaatcaaatgctgcaaagctctcattcaatccaaataccttcat |
27295807 |
T |
|
| Q |
201 |
caaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaaggagtactattctcaaacatacaagtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27295806 |
caaattgaatgaaaaatttgatctctaacaaattaaataaaaaattatgcagggtggatcaggttcagtacaaggagtactattctcaaacatacaagtt |
27295707 |
T |
|
| Q |
301 |
tcacaggttc |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
27295706 |
tcacaggttc |
27295697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 248 - 303
Target Start/End: Original strand, 14739019 - 14739074
Alignment:
| Q |
248 |
tgcagggtggatcaggttcagtacaaggagtactattctcaaacatacaagtttca |
303 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
14739019 |
tgcagggtggatctggttcagtacagggagtattattctcaaacatacaagtttca |
14739074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 14738667 - 14738722
Alignment:
| Q |
1 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaa |
56 |
Q |
| |
|
||||||||||| || || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14738667 |
gatgtcaacatacacgactcaatgaatggtgttagaatcaaaacatggcaggtaaa |
14738722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1449 times since January 2019
Visitors: 3669