View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_15 (Length: 338)
Name: NF0555_low_15
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 93 - 236
Target Start/End: Original strand, 27577963 - 27578103
Alignment:
Q |
93 |
attacgtcgatcagtctccaaaatcagtcactacaaaatttatagaattggtcactaaaatgcattaaacttgtttctaactacacatttgtgaataaaa |
192 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||| ||||||||| | |
|
|
T |
27577963 |
attacgtcgatcaatctccaaaatcagtcactacaaaatttatagaattggtcactaaaatgcactaaattggtttctaactacacgtttgtgaat---a |
27578059 |
T |
 |
Q |
193 |
atggtttaccactatatcacttcaagaaacaaggtacgtatatc |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27578060 |
atggtttaccactatatcacttcaagaaacaaggtacgtatatc |
27578103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1403 times since January 2019
Visitors: 3669