View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_17 (Length: 306)
Name: NF0555_low_17
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 4804260 - 4803988
Alignment:
Q |
19 |
cgacgaaattagcttttgctccataattgtattcactaatacatttgaacaccagtgtggatagctttggaaagaaagaatggtgaagattttctgcatt |
118 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||| |
|
|
T |
4804260 |
cgaccaaattagcttttgctccataattgtattcactaatacatttgaacaccagtgtggataggttaggaaagaaagaatggtgaagatttgctgcatt |
4804161 |
T |
 |
Q |
119 |
gatgctagatatgtatgggagtccaacaataacagtcattgtatttagatgtccatccattcaagcagctgtcgttgatagagcaatgcagccttgatat |
218 |
Q |
|
|
||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4804160 |
gatactagatatgtaagggagtccaataataacagtcattgtatttagatgtccatccattcaagcagctgtcgttgatagagcaatgcagccttgatat |
4804061 |
T |
 |
Q |
219 |
atatctcgaaatcgtgcattgcagccttgaatagcaatcaacttcctatctatgagccaggtattgatgatgt |
291 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4804060 |
atatctcgaaatcgtgcattgcagccttgaatagcaatcaacttcctatctatgagccaggtattgatgatgt |
4803988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 24 - 129
Target Start/End: Original strand, 4797744 - 4797849
Alignment:
Q |
24 |
aaattagcttttgctccataattgtattcactaatacatttgaacaccagtgtggatagctttggaaagaaagaatggtgaagattttctgcattgatgc |
123 |
Q |
|
|
|||||| ||||||| |||||||||||| | | |||||||||||||||| ||||||||| || |||||| || ||| |||||||||| |||||||| ||| |
|
|
T |
4797744 |
aaattaacttttgcagcataattgtatttattgatacatttgaacaccactgtggataggttaggaaaggaaaaattgtgaagatttgctgcattggtgc |
4797843 |
T |
 |
Q |
124 |
tagata |
129 |
Q |
|
|
| |||| |
|
|
T |
4797844 |
tggata |
4797849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 10775889 - 10775829
Alignment:
Q |
44 |
attgtattcactaatacatttgaacaccagtgtggatagctttggaaagaaagaatggtga |
104 |
Q |
|
|
|||||||| |||||||||||||||||||| | ||||||| || |||||| || |||||||| |
|
|
T |
10775889 |
attgtatttactaatacatttgaacaccactatggataggttaggaaaggaaaaatggtga |
10775829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 219 - 275
Target Start/End: Complemental strand, 10779451 - 10779395
Alignment:
Q |
219 |
atatctcgaaatcgtgcattgcagccttgaatagcaatcaacttcctatctatgagc |
275 |
Q |
|
|
|||||||||||||| ||||||||| | ||| | ||||||||||||||||||||||| |
|
|
T |
10779451 |
atatctcgaaatcgcgcattgcagtgtggaacaacaatcaacttcctatctatgagc |
10779395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1433 times since January 2019
Visitors: 3669