View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_18 (Length: 304)
Name: NF0555_low_18
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0555_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 40 - 285
Target Start/End: Complemental strand, 41598045 - 41597800
Alignment:
| Q |
40 |
catataagataccaaaatcaataatgtgaagggtttctgccttttcagctgttttcaatatcattttatttgcaaagaaatgcgcaaattttttgaaagg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41598045 |
catataagataccaaaatcaataatgtgaagggtttctgccttttcagctgttttcaatatcattttatttgcaaagaaatgcgcaaattttttgaaagg |
41597946 |
T |
 |
| Q |
140 |
gcaagcagagataaaaacttggtaagctttcaagaaatcagcagcactaaacatcttttggctcatatataatatttgtgtaccggtaccagcaccaacc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41597945 |
gcaagcagagataaaaacttggtaagctttcaagaaatcagcagcactaaacatcttttggctcatatataatatttgtgtaccggtaccagcaccaacc |
41597846 |
T |
 |
| Q |
240 |
atgcgcgcttcaatcgcattcgcaaagtaatgagccattctctgtg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41597845 |
atgcgcgcttcaatcgcattcgcaaagtaatgagccattctctgtg |
41597800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 40 - 139
Target Start/End: Original strand, 23912136 - 23912235
Alignment:
| Q |
40 |
catataagataccaaaatcaataatgtgaagggtttctgccttttcagctgttttcaatatcattttatttgcaaagaaatgcgcaaattttttgaaagg |
139 |
Q |
| |
|
|||||| ||||||||||||||| || ||||||||||| || ||| ||| | ||||| |||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
23912136 |
catataggataccaaaatcaatgatatgaagggtttcagcatttgcagaagctttcataatcattttatttgcaaagaagtatgcaaactttttgaaagg |
23912235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University