View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_19 (Length: 303)
Name: NF0555_low_19
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 60941 - 61124
Alignment:
Q |
1 |
attgtatgcaaaatgtcagatcccacttcattctctagaaagctaattagctaaatacaat----------gcaattctaggaagtacgaatgcatacat |
90 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
60941 |
attgtatgcaaaatgtcagatccaacttcattctctagaaagctaattagctaaatacaatgcaatgcaatgcaattctaggaagtacgaatgcatacac |
61040 |
T |
 |
Q |
91 |
ggacattggccacactattagtattgatacgttgatactagtagtaatgtaagaaaatgacatgattgcaattcaatcacatgt |
174 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
61041 |
ggacattggccacactattagtattgatacgttgatactagtagtaatgtaagaaaatgacatgattgcaattcaatcgcatgt |
61124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 170 - 243
Target Start/End: Original strand, 61212 - 61286
Alignment:
Q |
170 |
catgttataataacaataacaaattaaaaag-aaatatgtctgggcaggatcattcgatcaaaagtgtctgtgct |
243 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
61212 |
catgttataataacaataacaaattaaaaaggaaatatgtctgggtaggatcattcgatcaaaagtgtctgtgct |
61286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University