View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_21 (Length: 300)
Name: NF0555_low_21
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0555_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 29 - 269
Target Start/End: Complemental strand, 33599458 - 33599216
Alignment:
| Q |
29 |
accaatagctactctttctcttagttgtgaa--gtccttttatgtttgatacatattgttggtgcaaggctaaaaatccatttagacacatgtcagcttt |
126 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33599458 |
accaatggctactctttctcttagttgtgaaaagcccttttatgtttgatacatattgttggtgcagggctaaaaatccatttagacacatgtcagcttt |
33599359 |
T |
 |
| Q |
127 |
ggaggctgatgtaactccctttatgaacaagctatccgaacacaagtattttcctatttgttgattattttgatatatttttaatgtttaattatgtgaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33599358 |
ggaggctgatgtaactccctttatgaacaagctatccgaacacaagtattttcctatttgttgattattttgatatatttttaatgtttaattatgtgaa |
33599259 |
T |
 |
| Q |
227 |
tattcatgggcaatgtcatctttttagtgttgcgggttcaata |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33599258 |
tattcatgggcaatgtcatctttttagtgttgtgggttcaata |
33599216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University