View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0555_low_25 (Length: 246)

Name: NF0555_low_25
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0555_low_25
NF0555_low_25
[»] chr8 (1 HSPs)
chr8 (1-155)||(27295852-27296006)
[»] chr5 (1 HSPs)
chr5 (1-56)||(14738667-14738722)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 27296006 - 27295852
Alignment:
1 gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27296006 gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt 27295907  T
101 caaaatcatttcataccgataattgaatcttctctcaaagccaaataatgatgat 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
27295906 caaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgat 27295852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 14738667 - 14738722
Alignment:
1 gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaa 56  Q
    ||||||||||| ||  || ||||||||||||| |||||||||||||||||||||||    
14738667 gatgtcaacatacacgactcaatgaatggtgttagaatcaaaacatggcaggtaaa 14738722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University