View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_25 (Length: 246)
Name: NF0555_low_25
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 27296006 - 27295852
Alignment:
Q |
1 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27296006 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaaaaagattcctatatgttcatcaagcttatcagaaaatttaactt |
27295907 |
T |
 |
Q |
101 |
caaaatcatttcataccgataattgaatcttctctcaaagccaaataatgatgat |
155 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
27295906 |
caaaatcatttcataccgataattgaatcttctctcaaagccaaataattatgat |
27295852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 14738667 - 14738722
Alignment:
Q |
1 |
gatgtcaacatgcataacacaatgaatggtgtcagaatcaaaacatggcaggtaaa |
56 |
Q |
|
|
||||||||||| || || ||||||||||||| ||||||||||||||||||||||| |
|
|
T |
14738667 |
gatgtcaacatacacgactcaatgaatggtgttagaatcaaaacatggcaggtaaa |
14738722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 982 times since January 2019
Visitors: 3660