View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_26 (Length: 237)
Name: NF0555_low_26
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 2509835 - 2509999
Alignment:
Q |
1 |
taaacaaacgaataattcttgattatttgatatgcctggtttagattaaaagctagaattatctgacctatataaactttgaaactgttttttaagtggt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2509835 |
taaacaaacgaataattcttgattatttgatatgcctggtttaaattaaaagctagaattatctgacctatataaactttgaaactgttttttaagtggt |
2509934 |
T |
 |
Q |
101 |
aatccaattaccttaataattgcttttaagagattgatttctcctaaagggatgttctttcattc |
165 |
Q |
|
|
|||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||| |
|
|
T |
2509935 |
aatccaattaccttaataattgctaccaaaagattgatttgtcctaaagggatgttctttcattc |
2509999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 802 times since January 2019
Visitors: 3656