View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0555_low_27 (Length: 209)
Name: NF0555_low_27
Description: NF0555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0555_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 1383733 - 1383842
Alignment:
Q |
97 |
taaactgcatgcaggtgagaaaacaatataccttgctttgtatcaacttcttaacttgtttggattgagttattttagtttatctaatgacattgaacct |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
1383733 |
taaactgcatgcaggtgagaaaacaatataccttgctttgtatcaacttcttaacttgtttggattgagttattttagtttatctaatgacattgaactt |
1383832 |
T |
 |
Q |
197 |
atgatactac |
206 |
Q |
|
|
|||| ||||| |
|
|
T |
1383833 |
atgagactac |
1383842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 97 - 206
Target Start/End: Original strand, 1389838 - 1389947
Alignment:
Q |
97 |
taaactgcatgcaggtgagaaaacaatataccttgctttgtatcaacttcttaacttgtttggattgagttattttagtttatctaatgacattgaacct |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
1389838 |
taaactgcatgcaggtgagaaaacaatataccttgctttgtatcaacttcttaacttgtttggattgagttattttagtttatctaatgacattgaactt |
1389937 |
T |
 |
Q |
197 |
atgatactac |
206 |
Q |
|
|
|||| ||||| |
|
|
T |
1389938 |
atgagactac |
1389947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University