View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556-INSERTION-2 (Length: 184)
Name: NF0556-INSERTION-2
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 9e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 9e-75
Query Start/End: Original strand, 8 - 166
Target Start/End: Complemental strand, 34682163 - 34682001
Alignment:
| Q |
8 |
tatagttggtataaatcttgaaaatgtggttgctgaagctgaaaacacatcaaataatgtaatcagtaataaacaatgaccaagatcgataattaatata |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34682163 |
tatagttggtataaatcttgaaaatgtggttgctgaagctgaaaacacatcaaataatgtaatcagtaataaacaatgaccaagatcgataattaatata |
34682064 |
T |
 |
| Q |
108 |
gtcgaaaaaagatcgataactattgtgtatatgat----gtaaagacctagatacacatacat |
166 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34682063 |
gtcgaaaaaagatcgataactaatgtgtatatgatgtacgtaaagacctagatacacatacat |
34682001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University