View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556-INSERTION-5 (Length: 177)
Name: NF0556-INSERTION-5
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 21815650 - 21815487
Alignment:
| Q |
8 |
acctaagggttgagttgaccaagcaaagaggnnnnnnnagttcacgactctgaatgactttaaccggctttgcatggcaatcataaatcaacctgactcg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21815650 |
acctaagggttgagttgaccaagcaaagaggtttttttagttcacgactctgaatgaccttaaccggctttgcatggcaatcataaatcaacctgactcg |
21815551 |
T |
 |
| Q |
108 |
attttgtttgaacaaaaaccgagcagcttgagggatatctatggaaggataatgcaacaccaaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21815550 |
attttgtttgaacaaaaaccgagcagcttgagggatatctatggaagggtaatgcaaccccaaa |
21815487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University