View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_high_7 (Length: 354)
Name: NF0556_high_7
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 19345024 - 19344762
Alignment:
| Q |
1 |
taagataattgtgaaaattcaggtaagaatcattcaaagtagtgttgagttactgtgcttacttatagatctcctggctgcacaaaaccttcataaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19345024 |
taagataattgtgaaaattcaggtaagaatcattcaaagtagttttgagttactgtgcttacttatagatctcctggctgcacaaaaccttcataaaatt |
19344925 |
T |
 |
| Q |
101 |
tgcaaccataggctcaagtttacagtgtgtcgctgctatccccagctgtcgaagacctaatgccccgtgtctaacttcaactccatcatcctattcaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19344924 |
tgcaaccataggctcaagtttacagtgtgtcgctgctatccccagctgccgaagacctaatgccccgtgtctaacttcaactccatcatcctattcaatg |
19344825 |
T |
 |
| Q |
201 |
ccataatgctatatatgtttaaccaaaaacaggagtgataaatcatcatttatgggaagtaat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19344824 |
ccataatgctatatatgtttaaccaaaaacaggagtgataaatcatcaattatgggaagtaat |
19344762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University