View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_high_9 (Length: 228)
Name: NF0556_high_9
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0556_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 31979885 - 31979785
Alignment:
Q |
1 |
agtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31979885 |
agtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatc |
31979786 |
T |
 |
Q |
101 |
t |
101 |
Q |
|
|
| |
|
|
T |
31979785 |
t |
31979785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University