View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_low_10 (Length: 367)
Name: NF0556_low_10
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 57 - 340
Target Start/End: Complemental strand, 3856383 - 3856116
Alignment:
| Q |
57 |
gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataattattattttttctaannnnnnnnnatgtgtgtg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3856383 |
gcagagaccagatgcttgatcaacgttgcgaagcaacatgacatgaactccaaccttcaaacataattattattttttctaatttttttt-atgtgtgtg |
3856285 |
T |
 |
| Q |
157 |
actaaatagagtgaccaaatacttgtgtccattcaagaattgctccttttcaaaagcccnnnnnnnnnactttcaaaatcaacgaagaaggaggatcagc |
256 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3856284 |
ac-------------caaatacttgtgtccattcaagaattgctccttttcaaaagcccttttttt--actttcaaaatcaacgaagaaggaggatcagc |
3856200 |
T |
 |
| Q |
257 |
tcatggtttcttaaactatactccgtcctatgagttcttgcctctctttgaacatcaaaagagccaaaaggaacgttaaagatg |
340 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856199 |
tcatggtttcttaaactatactccgttctatgagttcttgcctctctttgaacatcaaaagagccaaaaggaacgttaaagatg |
3856116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 57 - 122
Target Start/End: Complemental strand, 46471415 - 46471350
Alignment:
| Q |
57 |
gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46471415 |
gcagagaccagatgcttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaaacataa |
46471350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 72 - 116
Target Start/End: Complemental strand, 33446177 - 33446133
Alignment:
| Q |
72 |
ttgatcaacgttgcgaagcaacatgacaggaactccaaccttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
33446177 |
ttgatcaacgttgcgaagcaacataacaggaacaccaaccttcaa |
33446133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 43377706 - 43377752
Alignment:
| Q |
151 |
tgtgtgactaaatagagtgaccaaatacttgtgtccattcaagaatt |
197 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||| |||||||| |
|
|
| T |
43377706 |
tgtgtgactaaatagagggtccaaattcttgtgtccatccaagaatt |
43377752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University