View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_low_14 (Length: 264)
Name: NF0556_low_14
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0556_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 31 - 242
Target Start/End: Complemental strand, 44853900 - 44853689
Alignment:
Q |
31 |
ggatatccatgtggatatggtggctgcacaaataacatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatat |
130 |
Q |
|
|
|||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
44853900 |
ggatatccatgtggatatggtggcagcacatatatcatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatct |
44853801 |
T |
 |
Q |
131 |
atagtctcattatgtagaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtgtctctcaatcgaaatatgcaaagataat |
230 |
Q |
|
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
44853800 |
atagtctcattacgtaaaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtatctctcaatcgaaatatgcaaagataac |
44853701 |
T |
 |
Q |
231 |
tggcagtattat |
242 |
Q |
|
|
|||||||||||| |
|
|
T |
44853700 |
tggcagtattat |
44853689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University