View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0556_low_14 (Length: 264)

Name: NF0556_low_14
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0556_low_14
NF0556_low_14
[»] chr4 (1 HSPs)
chr4 (31-242)||(44853689-44853900)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 31 - 242
Target Start/End: Complemental strand, 44853900 - 44853689
Alignment:
31 ggatatccatgtggatatggtggctgcacaaataacatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatat 130  Q
    |||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
44853900 ggatatccatgtggatatggtggcagcacatatatcatttttatccaataaggagcacacatatatcatactatcggtccatggatatccatttacatct 44853801  T
131 atagtctcattatgtagaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtgtctctcaatcgaaatatgcaaagataat 230  Q
    |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||     
44853800 atagtctcattacgtaaaaaaccttatgatgctagtacttgtttaatttaaagaaaaatagtgaaacttgtatctctcaatcgaaatatgcaaagataac 44853701  T
231 tggcagtattat 242  Q
    ||||||||||||    
44853700 tggcagtattat 44853689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University