View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_low_17 (Length: 235)
Name: NF0556_low_17
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 51000416 - 51000528
Alignment:
| Q |
42 |
tcataggaaccatgcttaaaagaaagatagcacagaaaatcaacacaattgtgcttgatattactaagattaaccagaattcttgttccaatgtagcatc |
141 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51000416 |
tcataggaaacatgcttaaaagaaagatagcacagaaaatcaacacaattgtgcttgatattactaagattaaccagaattctggttccaatgtagcatc |
51000515 |
T |
|
| Q |
142 |
atgtcatctgcat |
154 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51000516 |
atgtcatctgcat |
51000528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1098 times since January 2019
Visitors: 3663