View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0556_low_19 (Length: 208)

Name: NF0556_low_19
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0556_low_19
NF0556_low_19
[»] chr7 (1 HSPs)
chr7 (1-198)||(31979688-31979885)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 31979885 - 31979688
Alignment:
1 agtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31979885 agtttcaaacaccacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatc 31979786  T
101 ttcaactcctcactatgtcttctccaacaatgctgcttcttcttctgcttctcctcagtttgttgatgcttctgaccatgtcaatcttcatctcactc 198  Q
    ||| |||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||    
31979785 ttccactcctcactatgttttctccaacaatgctgcttctgcttctacttctcctcagtttgttgatgcttctgaccatgtcaatcttgatctcactc 31979688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University