View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_low_21 (Length: 203)
Name: NF0556_low_21
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 129
Target Start/End: Original strand, 51000416 - 51000528
Alignment:
| Q |
17 |
tcataggaaccatgcttaaaagaaagatagcacagaaaatcaacacaattgtgcttgatattactaagattaaccagaattctggttccaatgtagcatc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51000416 |
tcataggaaacatgcttaaaagaaagatagcacagaaaatcaacacaattgtgcttgatattactaagattaaccagaattctggttccaatgtagcatc |
51000515 |
T |
 |
| Q |
117 |
atgtcatctgcat |
129 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51000516 |
atgtcatctgcat |
51000528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University