View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0556_low_5 (Length: 434)
Name: NF0556_low_5
Description: NF0556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0556_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 104 - 356
Target Start/End: Original strand, 13333116 - 13333368
Alignment:
| Q |
104 |
atctatataataactaagaaaatattatatcaatagtcacactaacaaagtactggtgtgcatgcaaacaatattgttgcattagttttaccaatattaa |
203 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333116 |
atctatataataattaagaaaatattatatcaatagtcacaccaacaaagtactggtgtgcatgcaaacaatattgttgcattagttttaccaatattaa |
13333215 |
T |
|
| Q |
204 |
taattattctgcnnnnnnncaaccttataaaatccaaatacaaaaagcctatatatagatggattaacccctttgctctttgcatcattcacaacactac |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333216 |
taattattctgcaaaaaaacaaccttataaaatccaaatacaaaaagcctatatatagatggattaacccctttgctctttgcatcattcacaacactac |
13333315 |
T |
|
| Q |
304 |
tacaatggccaactctaacccaaagctccttgtgacacaaaaccccttctctg |
356 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13333316 |
tacaatggccaactcaaacccaaagctccttgtgacacaaaaccccttctctg |
13333368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 232 - 356
Target Start/End: Original strand, 13308081 - 13308203
Alignment:
| Q |
232 |
aaaatccaaatacaaaaagcctatatatagatggattaacccctttgctctttgcatcattcacaacactactacaatggccaactctaacccaaagctc |
331 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||| ||| ||||||||| | |||||||| ||||||| || ||| ||||||||||| | ||||| ||| |
|
|
| T |
13308081 |
aaaatcgaaatacaaaa-gcctatatatagatggactaatccctttgctatatgcatcatacacaaca-taataccatggccaactccataccaaaactc |
13308178 |
T |
|
| Q |
332 |
cttgtgacacaaaaccccttctctg |
356 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
13308179 |
cttgcaacacaaaaccccttctctg |
13308203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 325 times since January 2019
Visitors: 3649