View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0558_high_6 (Length: 271)
Name: NF0558_high_6
Description: NF0558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0558_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 256
Target Start/End: Original strand, 44083900 - 44084126
Alignment:
| Q |
30 |
aagaatactactagagatgcacataaataaagttatgtataaagatgataatattttttgcaagcaaattcagctaagtattgcttaggattaaagtgta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44083900 |
aagaatactactagagatgcacataaataaagttatgtataaagatgataatattttttgcaagcaaattcagctaagtattgcttagggttaaagtgta |
44083999 |
T |
|
| Q |
130 |
tgtgtattgtacagggaacaatcattatatggtacggcaggaatcaacagatagtaaacaaataaaccgacttcaaattgattgataatatatacatcgc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44084000 |
tgtgtattgtacagggaacaatcattatatggtacggcaggaatcaacagatagtaaacaaataaaccgacttcaaattgattgataatatatacatcac |
44084099 |
T |
|
| Q |
230 |
actcatagaataatctacccaccatct |
256 |
Q |
| |
|
||||||| |||||| || |||| |||| |
|
|
| T |
44084100 |
actcatataataatgtatccactatct |
44084126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1462 times since January 2019
Visitors: 3669