View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0558_low_7 (Length: 271)

Name: NF0558_low_7
Description: NF0558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0558_low_7
NF0558_low_7
[»] chr4 (1 HSPs)
chr4 (30-256)||(44083900-44084126)


Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 30 - 256
Target Start/End: Original strand, 44083900 - 44084126
Alignment:
30 aagaatactactagagatgcacataaataaagttatgtataaagatgataatattttttgcaagcaaattcagctaagtattgcttaggattaaagtgta 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
44083900 aagaatactactagagatgcacataaataaagttatgtataaagatgataatattttttgcaagcaaattcagctaagtattgcttagggttaaagtgta 44083999  T
130 tgtgtattgtacagggaacaatcattatatggtacggcaggaatcaacagatagtaaacaaataaaccgacttcaaattgattgataatatatacatcgc 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
44084000 tgtgtattgtacagggaacaatcattatatggtacggcaggaatcaacagatagtaaacaaataaaccgacttcaaattgattgataatatatacatcac 44084099  T
230 actcatagaataatctacccaccatct 256  Q
    ||||||| |||||| || |||| ||||    
44084100 actcatataataatgtatccactatct 44084126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 645 times since January 2019
Visitors: 3655