View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_high_13 (Length: 296)
Name: NF0559_high_13
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 4831301 - 4831035
Alignment:
| Q |
1 |
tgcatttgcatcatcaaattatttggaggataagatgttgatgatgagattgagagaaaagtagaaggagattctccattaggactagaactattgaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831301 |
tgcatttgcatcatcaaattatttggaggataagatgttgatgatgagattgagagaaaagtagaaggagattctccattaggactagaactattgaagg |
4831202 |
T |
|
| Q |
101 |
aagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagcaacaaggtcttgtggaggaatatttatgaatggtgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831201 |
aagcaaaagcattattattagggtttggtaaatggtaaagaaggcacaatccagcattagcaacaaggtcttgtggaggaatatttatgaatggtgatga |
4831102 |
T |
|
| Q |
201 |
aggatgagatgaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaacattc |
267 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831101 |
aggatgagaagaatttaacggtggttgggtttgatggagacgagcacggtcgcggcggtgaacattc |
4831035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 110 times since January 2019
Visitors: 3674