View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_high_16 (Length: 275)
Name: NF0559_high_16
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 33 - 233
Target Start/End: Complemental strand, 47249914 - 47249714
Alignment:
Q |
33 |
cagagaggcatttcatcaaacatgagggggacattggttgattggttagttgaggttgcagatgaatacaagcttcttcccgagacacttcatctgtcag |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47249914 |
cagagaggcatttcatcaaacatgagggggacattggttgattggttagttgaggttgcagatgaatacaagcttcttcccgagacacttcatctgtcag |
47249815 |
T |
 |
Q |
133 |
tttcatacattgacagattcttatctattgaacctgtcagcagatctaagcttcagttgctcggtgtttcatccatgctcattgcatcgtaagccctcaa |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47249814 |
tttcatacattgacagattcttatctattgaacctgtcagcagatctaagcttcagttgctcggtgtttcatccatgctcattgcatcgtaagccctcaa |
47249715 |
T |
 |
Q |
233 |
c |
233 |
Q |
|
|
| |
|
|
T |
47249714 |
c |
47249714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 36 - 225
Target Start/End: Complemental strand, 47243082 - 47242893
Alignment:
Q |
36 |
agaggcatttcatcaaacatgagggggacattggttgattggttagttgaggttgcagatgaatacaagcttcttcccgagacacttcatctgtcagttt |
135 |
Q |
|
|
||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||| || || |||||||| || |||| |
|
|
T |
47243082 |
agaggcattacatcaaacatgaggggcacattggttgattggttggttgaggttgcagatgaatacacgcttcttccagaaacccttcatctctctgttt |
47242983 |
T |
 |
Q |
136 |
catacattgacagattcttatctattgaacctgtcagcagatctaagcttcagttgctcggtgtttcatccatgctcattgcatcgtaag |
225 |
Q |
|
|
|||||||||| ||||||||||||| ||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
47242982 |
catacattgatagattcttatctaaccaacctatcattagatctaagcttcagttgcttggtgtttcatccatgctcattgcatcgtaag |
47242893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 54 - 225
Target Start/End: Complemental strand, 47254321 - 47254150
Alignment:
Q |
54 |
atgagggggacattggttgattggttagttgaggttgcagatgaatacaagcttcttcccgagacacttcatctgtcagtttcatacattgacagattct |
153 |
Q |
|
|
||||| |||| | ||||||||||||| ||||||||||| || |||||||||||||| || | || |||||||| | ||||||||||||||||||||| |
|
|
T |
47254321 |
atgagagggatactggttgattggttggttgaggttgctgaagaatacaagcttctccctcaaacccttcatcttgctgtttcatacattgacagattcc |
47254222 |
T |
 |
Q |
154 |
tatctattgaacctgtcagcagatctaagcttcagttgctcggtgtttcatccatgctcattgcatcgtaag |
225 |
Q |
|
|
| || | ||| |||||| ||||||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
T |
47254221 |
tgtccaatgagtctgtcaacagatctaagcttcaattgcttggtgtttcatccatgctcatcgcatcgtaag |
47254150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 227
Target Start/End: Original strand, 47265980 - 47266027
Alignment:
Q |
180 |
aagcttcagttgctcggtgtttcatccatgctcattgcatcgtaagcc |
227 |
Q |
|
|
|||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
T |
47265980 |
aagcttcaattgctgggtgtttcatccatgtacattgcatcgtaagcc |
47266027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 113 times since January 2019
Visitors: 3674