View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_high_19 (Length: 253)
Name: NF0559_high_19
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 39642210 - 39642086
Alignment:
Q |
1 |
cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39642210 |
cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc |
39642111 |
T |
 |
Q |
101 |
ggttttgccatgctttgtgcaggtt |
125 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
39642110 |
ggttttgccatgctttgtgcaggtt |
39642086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 46670407 - 46670283
Alignment:
Q |
1 |
cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc |
100 |
Q |
|
|
|||||| |||||||| |||||||||||||| ||||| ||||||| || |||||||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
T |
46670407 |
cggcttcaatgccgtcgcaaacaaattcatcgacacttcctatgctgtcgacaacacttaccttctattctcagcttaccttgtttttgccatgcaacta |
46670308 |
T |
 |
Q |
101 |
ggttttgccatgctttgtgcaggtt |
125 |
Q |
|
|
|||||||| ||||||||||| |||| |
|
|
T |
46670307 |
ggttttgctatgctttgtgccggtt |
46670283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 125
Target Start/End: Complemental strand, 17091441 - 17091363
Alignment:
Q |
47 |
gttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactcggttttgccatgctttgtgcaggtt |
125 |
Q |
|
|
|||||||||||||| ||| | ||||| |||||||||| || | |||||||| |||||||||||||| ||||| |||| |
|
|
T |
17091441 |
gttgacaacacctatcttttattctcagcttaccttgtcttctctatgcaacttggttttgccatgctctgtgctggtt |
17091363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University