View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0559_high_19 (Length: 253)

Name: NF0559_high_19
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0559_high_19
NF0559_high_19
[»] chr7 (2 HSPs)
chr7 (1-125)||(39642086-39642210)
chr7 (1-125)||(46670283-46670407)
[»] chr1 (1 HSPs)
chr1 (47-125)||(17091363-17091441)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 39642210 - 39642086
Alignment:
1 cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39642210 cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc 39642111  T
101 ggttttgccatgctttgtgcaggtt 125  Q
    |||||||||||||||||||||||||    
39642110 ggttttgccatgctttgtgcaggtt 39642086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 46670407 - 46670283
Alignment:
1 cggctttaatgccgttgcaaacaaattcattgacacaacctatgccgttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactc 100  Q
    |||||| |||||||| |||||||||||||| |||||  ||||||| || |||||||| |||||||| |||||  |||||||||||||||||||||||||     
46670407 cggcttcaatgccgtcgcaaacaaattcatcgacacttcctatgctgtcgacaacacttaccttctattctcagcttaccttgtttttgccatgcaacta 46670308  T
101 ggttttgccatgctttgtgcaggtt 125  Q
    |||||||| ||||||||||| ||||    
46670307 ggttttgctatgctttgtgccggtt 46670283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 125
Target Start/End: Complemental strand, 17091441 - 17091363
Alignment:
47 gttgacaacacctaccttctcttctcttcttaccttgtttttgccatgcaactcggttttgccatgctttgtgcaggtt 125  Q
    |||||||||||||| ||| | |||||  |||||||||| ||  | |||||||| |||||||||||||| ||||| ||||    
17091441 gttgacaacacctatcttttattctcagcttaccttgtcttctctatgcaacttggttttgccatgctctgtgctggtt 17091363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1844 times since January 2019
Visitors: 3673