View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_high_22 (Length: 251)
Name: NF0559_high_22
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 43498595 - 43498835
Alignment:
| Q |
1 |
atgaatgataaggataaggataagaggaatgggataatggtgagtgaggttgttaaggaatatgcactacaaagaggatttgaagtgtatgagaatatgc |
100 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498595 |
atgaatgataaggacagggataagaggaatgggataatggtgagtgaggttgttaaggaatatgcactacaaagaggatttgaagtgtatgagaatatgc |
43498694 |
T |
|
| Q |
101 |
gtatgagtaaggttgaaatgaatgaagcagcattgacatctgtggctagaatggctatggcaatgagtgatggtgacaaggcttttgagatggttaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498695 |
gtatgagtaaggttgaaatgaatgaagcagcattgacatctgtggctagaatggccatggcattgagtgatggtgacaaggcttttgagatggttaaaca |
43498794 |
T |
|
| Q |
201 |
aatgaagattttagggataaatcctaggttaaggtcctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43498795 |
aatgaagattttagggataaatcctaggttaaggtcttatg |
43498835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 151 times since January 2019
Visitors: 3674