View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0559_high_7 (Length: 387)

Name: NF0559_high_7
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0559_high_7
NF0559_high_7
[»] chr6 (1 HSPs)
chr6 (31-151)||(6714033-6714153)
[»] chr1 (1 HSPs)
chr1 (207-292)||(6486275-6486360)


Alignment Details
Target: chr6 (Bit Score: 121; Significance: 7e-62; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 31 - 151
Target Start/End: Original strand, 6714033 - 6714153
Alignment:
31 gccttacatcaaagggtacgtaagtcagagaccacatctctttgattggaaactagaaaaccctagataattgatccgcaaagcaagaacctataccaag 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6714033 gccttacatcaaagggtacgtaagtcagagaccacatctctttgattggaaactagaaaaccctagataattgatccgcaaagcaagaacctataccaag 6714132  T
131 atattaaacaaccactttcac 151  Q
    |||||||||||||||||||||    
6714133 atattaaacaaccactttcac 6714153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 207 - 292
Target Start/End: Original strand, 6486275 - 6486360
Alignment:
207 gtgaaccgattagtgaattctgtggaggtgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattc 292  Q
    ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6486275 gtgaaccaattagtgaattctgtggaggcgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattc 6486360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1554 times since January 2019
Visitors: 3672