View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_high_8 (Length: 332)
Name: NF0559_high_8
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 322
Target Start/End: Original strand, 43319548 - 43319869
Alignment:
Q |
1 |
tgcctcttgtttagcctatcattttattcattttgagaaatgaacttggtcgtaagagttgaaaagtattgttccaaaccttacctatgttgtttactct |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43319548 |
tgcctcttgtttagcctatcattttattcattttgagaaatgaacttggtcgtaagagttgaaaagtattgttccaaaccttacctatgttgtttactct |
43319647 |
T |
 |
Q |
101 |
ttcaagtttgggagttaagggaaaaatgatatgaagtgtccaatatccatcaaaacaagtagcattgatgtcatctatatctcatttctcatcatgcctg |
200 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43319648 |
ttcaagtttgggagttgagggaaaaatgatatgaagtgtccaatatccatcaaaacaagtagcattgatgtcatctatatctcatttctcatcatgcctg |
43319747 |
T |
 |
Q |
201 |
atatacacgcttcataaatattaacataagaatgcctttgttttcttgcttgtaattgatggcataatcactttgggatatgaaatggacttattgtttc |
300 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
43319748 |
atatacacgcttcataaatattaacataagaatgcatttgttttcttgcttgtaattgatggcataatcactttgggatgtgaaatggacttattgtttc |
43319847 |
T |
 |
Q |
301 |
tacttttatgacaggttctctg |
322 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
43319848 |
tacttttatgacaggttctctg |
43319869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University