View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_10 (Length: 435)
Name: NF0559_low_10
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 2e-74; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 155 - 308
Target Start/End: Original strand, 43319185 - 43319338
Alignment:
Q |
155 |
atatgcaaggtggttgcagttggagagtgtgggttagactatgaccggcttcatttttgccccaccgagattcaaaagaggtacgtactgtttacctgtt |
254 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
43319185 |
atatgcaaggtggttgcagttggagagtgtggattagactatgaccggcttcatttttgccccgccgagattcaaaagaggtacgtactgtttacctgtt |
43319284 |
T |
 |
Q |
255 |
gctacgcatgttgcttttgtaatcccccatttaaaaaatattaaactattagaa |
308 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43319285 |
gctacgcatgttacttttgtaatcccccatttaaaaaatattaaactattagaa |
43319338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 325 - 425
Target Start/End: Original strand, 43319324 - 43319424
Alignment:
Q |
325 |
attaaactattagaattattaatgaaattttgttgttgtttgtgaatgctaggtatttcgagaagcaatttgaattggcatacatcacaaaattgcctat |
424 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43319324 |
attaaactattagaattattaatgaaattttgttgttgtttgtgaatgctaggtatttcgagaagcaatttgaattggcatacatcacaaaattgcctat |
43319423 |
T |
 |
Q |
425 |
g |
425 |
Q |
|
|
| |
|
|
T |
43319424 |
g |
43319424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 43319083 - 43319157
Alignment:
Q |
30 |
ctatacatgtcacaatgtatgttgatattcatgtagttgcagaacttgtgctctagttctaagactactgtccaa |
104 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||| |||||||||||| |
|
|
T |
43319083 |
ctatacatgtcacaatgtatgttgttattcatgtagttgctgaacttttgctctagttctaaaactactgtccaa |
43319157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1393 times since January 2019
Visitors: 3669