View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_15 (Length: 387)
Name: NF0559_low_15
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 7e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 31 - 151
Target Start/End: Original strand, 6714033 - 6714153
Alignment:
Q |
31 |
gccttacatcaaagggtacgtaagtcagagaccacatctctttgattggaaactagaaaaccctagataattgatccgcaaagcaagaacctataccaag |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6714033 |
gccttacatcaaagggtacgtaagtcagagaccacatctctttgattggaaactagaaaaccctagataattgatccgcaaagcaagaacctataccaag |
6714132 |
T |
 |
Q |
131 |
atattaaacaaccactttcac |
151 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
6714133 |
atattaaacaaccactttcac |
6714153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 207 - 292
Target Start/End: Original strand, 6486275 - 6486360
Alignment:
Q |
207 |
gtgaaccgattagtgaattctgtggaggtgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattc |
292 |
Q |
|
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6486275 |
gtgaaccaattagtgaattctgtggaggcgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattc |
6486360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University