View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_28 (Length: 299)
Name: NF0559_low_28
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 3 - 198
Target Start/End: Original strand, 45659166 - 45659361
Alignment:
Q |
3 |
tttgatgcaaaatatgttcttgttttttgatgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttat |
102 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45659166 |
tttgatgcaaactatgttcttgttttttgatgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttat |
45659265 |
T |
 |
Q |
103 |
ggagtgatgcactttgatataccaagttctgccaatactctcacaaacttcatgggttcaactttcttgctctctcttgttggtggcttcatctca |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
T |
45659266 |
ggagtgatgcactttgatataccaagttctgcaaatactctcacaaacttcatgggttcaactttcttgctttctctagttggtggcttcatctca |
45659361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 37984345 - 37984180
Alignment:
Q |
33 |
tgtagtattgtcagcattggacaacatgggttttgtggcaaacatggttagcttagttctatatttttatggagtgatgcactttgatataccaagttct |
132 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||||| |||||||||| |||||||| ||||| ||| ||||||||||||||||||| | |||| ||| |
|
|
T |
37984345 |
tgtagttttgtcagcattggataacatgggttttgtgacaaacatggtgagcttagtactatactttattggagtgatgcactttgatctttcaagctct |
37984246 |
T |
 |
Q |
133 |
gccaatactctcacaaacttcatgggttcaactttcttgctctctcttgttggtggcttcatctca |
198 |
Q |
|
|
||||| ||| | ||||| || ||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
T |
37984245 |
gccaacactttgacaaattttatgggctcaactttcttgctctctcttgttggtgccttcatctca |
37984180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University